Primer Melting Temperature Calculator

Determine your primer Tm fast. Input sequence or counts for three validated methods. Download data as a CSV or PDF file.

Calculator

Accepted: A T G C N. Maximum 200 nucleotides.

Advanced Options

Typical PCR buffer: 50 mM.
Used in nearest-neighbor method.
Applies −1 °C per mismatch.

Example Primer Data

The table below lists representative primers with pre-calculated Tm values. All values are computed at 50 mM Na¹ and 250 nM primer concentration.

Primer ID Sequence (5′→3′) Length GC% Tm Wallace (°C) Tm GC (°C) Tm NN (°C) Ta (°C) Quality
FWD_01ATGCGATCGATCGATCGAT1947.45857.458.653.6Optimal
FWD_02GCGCATCGATCGATCGCG1861.16462.863.958.9Acceptable
REV_01TATACGATCGATCGATCGA1942.15655.156.351.3Acceptable
REV_02CGCGATCGATCGATCGATCG2055.06462.263.458.4Optimal
GC_RICHGCGCGCATCGATCGCGCG1872.26866.167.462.4Suboptimal

How to Use This Calculator

  1. Select your input mode. Choose "Enter Sequence" to paste a raw primer. Choose "Enter Nucleotide Counts" if you have base counts without the full sequence.
  2. Enter the primer sequence. Type or paste the 5′-to-3′ sequence in the textarea. Only A, T, G, C, and N are accepted. The maximum length is 200 nucleotides.
  3. Set Na¹ concentration. Enter the monovalent salt concentration of your buffer in mM. The default is 50 mM, which matches most standard PCR buffers.
  4. Set primer concentration. Enter the primer concentration in nM. This value is used only in the nearest-neighbor calculation. The default is 250 nM.
  5. Enter mismatch count. If your primer contains deliberate mismatches with the template, enter the count. A correction of −1 °C per mismatch is applied to all three Tm values.
  6. Click Calculate Tm. The page reloads and displays all results directly above the form, below this header.
  7. Review thermodynamic data. The result table includes ΔH°, ΔS°, ΔG°(37 °C), self-complementarity, hairpin potential, and primer quality score.
  8. Explore the charts. Two interactive Plotly charts appear with the results. One compares Tm across methods. The second shows your primer on a Tm-vs-GC% curve.
  9. Download your report. Use the CSV button for spreadsheet import. Use the PDF button for a formatted, printable report. Both include all calculated parameters.

Formulas Used

1. Wallace Rule

Tm = 2(A + T) + 4(G + C)

A, T, G, C represent the individual base counts. This rule assumes 1 M NaCl. It is best suited for primers of 14–20 nt and provides a rapid estimate.

2. GC Content Method (Marmur–Doty Modified)

Tm = 81.5 + 16.6 × log₁₀([Na¹]) + 41 × fGC − 675/N

fGC is the fraction of G+C bases. N is the total primer length. [Na¹] is the salt concentration in molar. This formula is more accurate than the Wallace Rule for primers of 15–50 nt.

3. Nearest-Neighbor Method (SantaLucia 1998)

Tm = (1000 × ΔH°) / (ΔS° + R × ln(CT/4)) − 273.15

ΔH° (kcal/mol) and ΔS° (cal/mol·K) are the sum of all nearest-neighbor dinucleotide contributions plus initiation parameters. R = 1.987 cal/mol·K. CT is the total strand concentration in mol/L.

Salt correction: Tmcorrected = Tm + 16.6 × log₁₀([Na¹])

4. Annealing Temperature

Ta = Tm (Nearest-Neighbor) − 5 °C

The annealing temperature is used as the PCR annealing step setting. It ensures efficient primer hybridization while minimizing nonspecific binding.

5. Mismatch Correction

Tmadj = Tm − (mismatches × 1 °C)

This is an empirical approximation. The actual effect of a mismatch depends on its type, position, and surrounding sequence context.

6. SantaLucia 1998 Nearest-Neighbor Parameters

Unified thermodynamic parameters for DNA/DNA duplexes in 1 M NaCl, pH 7.0 (SantaLucia 1998, PNAS 95:1460–1465).

Sequence (5′→3′ / 3′→5′) ΔH° (kcal/mol) ΔS° (cal/mol·K) ΔG°₃₇ (kcal/mol)
AA / TT−7.9−22.2−1.0
AT / TA−7.2−20.4−0.9
TA / AT−7.2−21.3−0.6
CA / GT−8.5−22.7−1.5
GT / CA−8.4−22.4−1.5
CT / GA−7.8−21.0−1.3
GA / CT−8.2−22.2−1.3
CG / GC−10.6−27.2−2.2
GC / CG−9.8−24.4−2.2
GG / CC−8.0−19.9−1.8

Initiation: Terminal G·C pair ΔH° = +0.1 kcal/mol, ΔS° = −2.8 cal/mol·K. Terminal A·T pair ΔH° = +2.3 kcal/mol, ΔS° = +4.1 cal/mol·K.

Primer Melting Temperature: A Comprehensive Guide

Primer melting temperature (Tm) is a fundamental concept in molecular biology. It defines the temperature at which exactly half of all primer-template duplexes are dissociated into single strands. The other half remain hybridized. This equilibrium point determines how primers behave during the polymerase chain reaction.

Accurate Tm prediction is essential for PCR success. The annealing step in every PCR cycle depends on it. Primers that anneal at the wrong temperature produce either no amplification or nonspecific products. Understanding Tm allows researchers to design reliable, reproducible experiments.

The Three Estimation Methods

Three main approaches exist for calculating Tm. Each differs in accuracy and computational complexity. The Wallace Rule is the simplest. The GC Content Method adds salt correction. The nearest-neighbor method is the most rigorous and most accurate.

The Wallace Rule assigns 2 °C to each A-T pair and 4 °C to each G-C pair. G-C pairs contribute more because they form three hydrogen bonds. A-T pairs form only two. This method is adequate for quick estimations of short primers. It becomes less accurate for primers longer than 20 nucleotides.

The GC Content Method, modified from the Marmur and Doty equation, incorporates both GC fraction and primer length. It includes a salt correction term using log₁₀ of the Na¹ concentration. This makes it more applicable to real experimental conditions. It performs well for primers between 15 and 50 nucleotides.

Nearest-Neighbor Thermodynamics

The nearest-neighbor method is grounded in physical chemistry. It was unified and refined by SantaLucia in 1998. The method sums the enthalpy (ΔH°) and entropy (ΔS°) contributions of every consecutive dinucleotide pair in the sequence. These parameters reflect the stabilizing interactions between stacked base pairs.

The calculation also includes initiation parameters. Terminal A-T pairs are slightly destabilizing compared to terminal G-C pairs. Both 5′ and 3′ terminal base pairs receive initiation corrections. Once ΔH° and ΔS° are summed, Tm is derived from the thermodynamic relationship involving the gas constant and strand concentration.

The nearest-neighbor method provides access to the full thermodynamic profile. Researchers obtain ΔH° in kcal/mol, ΔS° in cal/mol·K, and ΔG° at 37 °C. These values quantify primer-template binding affinity at the molecular level. A more negative ΔG° indicates a more stable and tighter-binding primer.

Salt and Strand Concentration Effects

Salt concentration significantly affects Tm. Monovalent cations, particularly Na¹, neutralize the negative charges on the DNA backbone. This reduces the electrostatic repulsion between the two strands. Higher salt concentrations stabilize the duplex and increase Tm. A 10-fold increase in Na¹ raises Tm by approximately 16.6 °C.

Primer concentration influences the nearest-neighbor Tm calculation through the strand concentration term CT. Higher primer concentrations slightly increase Tm. Standard PCR reactions typically use 100 to 500 nM primers. The default value of 250 nM in this calculator reflects common practice.

Self-Complementarity and Hairpin Structures

Primers that can fold back on themselves form hairpin structures. These intramolecular folds compete with primer-template hybridization. A hairpin stem of four or more base pairs is considered significant. It can reduce the effective primer concentration and decrease PCR yield.

Self-complementarity is expressed as a percentage. It measures how many bases are complementary to their mirror positions in the reverse complement. Values above 50% suggest a high risk of secondary structure formation. Primers with both high self-complementarity and strong hairpin stems should be redesigned.

Primer Quality and Design Guidelines

Optimal primers have GC content between 40% and 60%. They are 18 to 25 nucleotides long. The Tm values of forward and reverse primers should be within 2 °C of each other. This ensures both primers anneal efficiently at the same temperature.

Avoid runs of four or more identical bases. Avoid guanine runs at the 3′ end, as G-quartets can cause polymerase stalling. Verify that the 3′ end of the primer does not form a dimer with itself or its partner primer. Three-prime dimers lead to extension of primer-primer products instead of the target.

Mismatches can be introduced deliberately for mutagenesis or restriction site addition. Each mismatch reduces Tm by approximately 1 °C in practice. This calculator applies that correction empirically. For critical applications, full thermodynamic modeling of mismatched duplexes provides a more precise estimate.

This calculator combines all three methods into a single tool. It provides Tm values, thermodynamic parameters, quality assessment, and downloadable reports. Use the nearest-neighbor Tm as your primary reference. Set your PCR annealing temperature to Ta = Tm − 5 °C as a reliable starting point.

Frequently Asked Questions

1. What is primer melting temperature?

Primer melting temperature (Tm) is the temperature at which 50% of primer-template duplexes are in the double-stranded state. The other 50% are dissociated. It depends on sequence length, base composition, salt concentration, and primer concentration. Tm is the key parameter for setting the PCR annealing step.

2. Which Tm method is most accurate?

The nearest-neighbor method (SantaLucia 1998) is the most accurate. It uses experimentally derived thermodynamic parameters for all 10 unique DNA dinucleotide pairs. It accounts for sequence context, salt concentration, and primer concentration. The Wallace Rule is faster but less precise for primers longer than 20 nt.

3. How does Na¹ concentration affect Tm?

Higher Na¹ concentration stabilizes the DNA duplex and increases Tm. Monovalent cations neutralize the negative phosphate charges on each DNA strand. This reduces strand repulsion. A 10-fold increase in Na¹ raises Tm by approximately 16.6 °C using the standard log correction formula.

4. What is annealing temperature and how is it set?

Annealing temperature (Ta) is the PCR step temperature at which primers bind the template. This calculator sets Ta = Tm (nearest-neighbor) − 5 °C. This margin ensures efficient hybridization. If nonspecific products appear, increase Ta by 1–2 °C increments until specificity improves.

5. How do mismatches affect Tm?

Each mismatch destabilizes the primer-template duplex and lowers the Tm. This calculator applies an empirical correction of −1 °C per mismatch. The actual effect varies with mismatch type and position. A mismatch at the 3′ end reduces extension efficiency more than one near the 5′ end.

6. What is the ideal GC content for a primer?

The ideal GC content is 40–60%. This range provides adequate duplex stability without excessive secondary structure formation. Primers below 30% GC have low Tm and reduced specificity. Primers above 70% GC risk forming stable hairpins and G-quadruplexes that impair hybridization and extension.

7. What does self-complementarity percentage mean?

It measures the fraction of bases that are complementary to their mirror positions in the reverse complement strand. A high percentage indicates a risk of hairpin or homodimer formation. These intramolecular structures compete with template binding. Values above 50% suggest the primer sequence should be revised before ordering.

8. Can this calculator be used for RNA primers or probes?

No. This calculator uses DNA/DNA thermodynamic parameters from SantaLucia 1998. These are not valid for RNA-DNA or RNA-RNA duplexes. For RNA oligonucleotides, use RNA-specific nearest-neighbor parameters from Sugimoto (1995) or Xia (1998). These datasets account for the structural differences of RNA duplexes.

Related Calculators

titration curve calculatorcodon usage calculatorrna concentration calculatoramino acid mass calculatorbradford assay calculatorlineweaver burk plot calculator

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.