Codon Usage Analyzer Calculator

Reveal sequence bias using clear codon usage statistics. Compare frames, strands, and genetic codes easily. Download CSV or PDF outputs for fast sharing today.

Analyzer inputs

Paste plain sequence or FASTA. Non-ACGTU characters are ignored.

Formula used

  • Codon frequency (%) = (codon_count / total_codons) × 100
  • Codons per 1000 = (codon_count / total_codons) × 1000
  • GC (%) = ((G + C) / sequence_length) × 100
  • GC3 (%) = (GC at 3rd positions / number_of_codons) × 100
  • RSCU = observed_count / expected_count, where expected_count = (amino_acid_total / number_of_synonymous_codons)

How to use this calculator

  1. Choose DNA or RNA, then paste your sequence (FASTA is supported).
  2. Select reading frame (1–3) and strand. Antisense uses reverse-complement.
  3. Select a genetic code table matching your organism or context.
  4. Click Analyze to view totals, top codons, and full codon usage.
  5. Use Download CSV or Download PDF to export your results.

Professional article

1) What codon usage measures

Codon usage describes how often each synonymous nucleotide triplet appears in a coding sequence. Multiple codons can encode the same amino acid, yet biological systems often prefer some codons over others. In quantitative modeling, this bias is treated like a distribution over discrete symbols, enabling comparisons between genes, strains, or design variants.

2) Core outputs: counts, frequencies, and per‑1000 rates

This analyzer reports raw codon counts and converts them into frequency (%) and codons per 1000. Per‑1000 rates help compare sequences of different lengths without losing interpretability. When you align these metrics with amino‑acid totals, you can separate protein composition effects from true synonymous selection.

3) GC and GC3 as compositional constraints

GC% summarizes the fraction of G and C across the cleaned sequence, while GC3% focuses only on third codon positions. GC3 often changes rapidly under mutational pressure and can dominate synonymous patterns. In simulation workflows, GC and GC3 can be treated as constraints when generating synthetic sequences or evaluating null models.

4) RSCU for synonym‑normalized bias

Relative Synonymous Codon Usage (RSCU) normalizes each codon against the expectation under equal use among synonyms for the same amino acid. An RSCU near 1 indicates neutral usage; values above 1 indicate preference. Because it controls for amino‑acid totals, RSCU is well suited for cross‑gene comparisons and clustering analyses.

5) Reading frame and strand matter

Codons depend on reading frame, so shifting frame changes every triplet boundary and can transform the statistical signature. Strand selection is equally important: antisense analysis uses the reverse‑complement and may be useful for validation or when sequences are provided in an opposite orientation. Always analyze the biologically relevant coding frame to avoid misleading bias patterns.

6) Genetic code selection

Different organisms and organelles decode codons differently. Selecting an appropriate genetic code table ensures correct amino‑acid mapping and stop identification, which directly affects amino‑acid totals and RSCU expectations. For mitochondrial sequences, using a mitochondrial code can change STOP assignments and recast interpretation of apparent anomalies.

7) Interpreting results for design and modeling

Codon preference can correlate with tRNA availability, translation speed, and error rates. In applied contexts, codon optimization balances expression goals against constraints such as GC3, motif avoidance, and secondary‑structure propensity. For computational studies, these outputs support hypothesis testing by comparing observed distributions against randomized sequences matched on amino‑acid content or GC.

8) Reporting, exporting, and reproducibility

Exporting tables to CSV supports downstream statistics, while PDF export is useful for lab notebooks, reports, and peer review. For reproducible workflows, record the input sequence source, frame, strand, and code table. When comparing datasets, standardize these settings so differences reflect biology or design choices rather than analysis configuration.

FAQs

1) What sequence formats are supported?

Paste plain DNA/RNA or FASTA. Headers starting with “>” are ignored, and non‑nucleotide characters are removed. The cleaned sequence preview shows what was actually analyzed.

2) What happens if I paste RNA with U characters?

RNA input is accepted. U is converted to T internally so codons can be mapped consistently. Your results still represent the same triplets, just expressed in the standard DNA alphabet.

3) Why do I see stop codons in the table?

Stops are part of the genetic code and may appear in short sequences, incomplete CDS, or incorrect frames. They are counted for frequency, but RSCU is not reported for stop codons.

4) Why does changing the reading frame change everything?

Frames shift triplet boundaries. A one‑base offset produces a completely different codon series and usually introduces premature stops. Use the coding frame defined by your annotation or ORF.

5) When should I use the reverse‑complement option?

Use it if your sequence is provided in antisense orientation or you want to verify orientation assumptions. For typical coding sequences already in the correct direction, keep the sense option.

6) What does an RSCU value of 2 mean?

It means the codon is used about twice as often as expected under equal usage among synonymous codons for that amino acid, given the amino‑acid total in your sequence.

7) How long should a sequence be for reliable codon usage?

Longer coding sequences are better. Very short inputs can be dominated by chance, especially for rare codons. For organism‑level profiles, aggregate many CDS or a full gene set.

Example data table

Example sequence (DNA) Frame Expected notes
ATGGCTGCTGCTGAACTGCTGCTTAA 1 Starts with ATG (M). Ends with TAA stop. High GCT/GAA usage in this short sample.
AUGGCU... (RNA input allowed) 1 U is converted to T for analysis. Codons are computed after cleaning.

Tip: For realistic codon usage, analyze longer coding sequences (CDS) from the same gene set or organism.


Related Calculators

Membrane potential calculatorGoldman equation calculatorDonnan equilibrium calculatorIon channel conductancePatch clamp sealCable length constantMembrane time constantAxon conduction velocityHodgkin Huxley solverAction potential threshold

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.