Model probe binding with sequence-aware thermal estimates. Adjust salts, formamide, and mismatches for stronger decisions. Plan hybridization settings with cleaner, faster, more reproducible experiments.
| Probe | Sequence | Length | GC% | Salt (M) | Formamide% | Mismatches | Duplex | Adjusted Tm | Hybridization Temp |
|---|---|---|---|---|---|---|---|---|---|
| Probe A | ATGCGTACGTTAGCGTACGT | 20 | 50.00 | 0.90 | 0 | 0 | DNA/DNA | 71.24 °C | 51.24 °C |
| Probe B | GGCTAACCGTAGGCTAACCGTAGA | 24 | 54.17 | 0.60 | 20 | 1 | DNA/RNA | 66.63 °C | 46.63 °C |
| Probe C | ATATGCCATATGCCATGC | 18 | 44.44 | 0.30 | 30 | 2 | DNA/DNA | 37.11 °C | 17.11 °C |
These rows illustrate how sequence composition, salt, formamide, and mismatches shift adjusted melting temperature and the recommended hybridization setting.
Tm = 2 × (A + T + U) + 4 × (G + C)
Tm = 81.5 + 16.6 × log10[Salt] + 0.41 × GC% − 600 / Length
Adjusted Tm = Base Tm + Duplex Adjustment − (0.62 × Formamide%) − (Mismatch Count × Penalty)
Hybridization Temperature = Adjusted Tm − Stringency Offset
This calculator uses practical screening equations for probe planning. It is useful for comparing candidates and testing conditions, but final assay optimization should still be validated experimentally.
Enter a probe sequence to let the page derive length and GC content automatically. If you do not have a sequence yet, leave that box empty and supply manual length plus GC content.
Choose the duplex type that best matches your experiment. DNA/RNA and RNA/RNA settings apply a higher thermal stability adjustment than DNA/DNA.
Fill in monovalent salt concentration, formamide percentage, mismatch count, and penalty per mismatch. Then set how many degrees below adjusted Tm you want to run the hybridization.
Press the calculate button. The page shows the recommended hybridization temperature above the form, a detailed summary table, and a Plotly graph showing how formamide shifts the working temperature.
Use the export buttons to save the results as CSV or PDF for protocols, planning files, or lab notes.
It is the working temperature used to let a probe bind its complementary target with the desired specificity. It is usually set below the adjusted melting temperature.
Tm marks the midpoint where half of duplexes are melted. Hybridization generally runs below that point so stable duplexes can form while still preserving stringency.
Formamide lowers duplex stability, so both adjusted Tm and the recommended hybridization temperature drop as the percentage rises. That helps tune stringency at lower temperatures.
Salt shields phosphate backbone repulsion. Higher monovalent salt usually stabilizes duplex formation, which increases the estimated melting temperature and shifts the working temperature upward.
Each mismatch lowers stability. This calculator applies a user-defined penalty per mismatch so you can quickly test how imperfect complementarity changes recommended conditions.
Wallace rule is best for quick estimates on short oligonucleotides when a real sequence is available. Longer probes benefit from the broader empirical equation used here.
Yes. The duplex selector includes DNA/RNA and RNA/RNA options, adding a simple stability adjustment to support common probe-target combinations.
It is excellent for screening and planning. Final assay conditions should still be confirmed with empirical testing, probe chemistry details, and platform-specific validation.
Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.