ORF Finder Input
Example Data Table
| Example Name | DNA Sequence | Expected ORF Count | Longest ORF | Example Peptide |
|---|---|---|---|---|
| Example A | ATGAAACCCGGGTAAATGTTTTAG | 2 | 15 nt | MKPG |
| Example B | ATGCCCATGTGATAG | 1 | 15 nt | MPM |
| Example C | CCCATGAAAGGGCCCTAA | 1 | 15 nt | MKGP |
These rows demonstrate typical complete ORFs using the default start and stop codons.
Formula Used
1) ORF Length
ORF length (nt) = End position - Start position + 1
2) Peptide Length
Peptide length (aa) = (ORF length ÷ 3) - 1 for complete ORFs with a terminal stop codon excluded from translation output.
3) GC Content
GC% = ((Count of G + Count of C) ÷ Sequence length) × 100
4) Reverse Strand Search
Reverse-strand ORFs are detected by scanning the reverse complement, then mapping those coordinates back onto the original sequence.
How to Use This Tool
- Enter a sequence name for easier exports.
- Paste a DNA sequence or FASTA record.
- Choose forward, reverse, or both strands.
- Set minimum and optional maximum ORF length.
- Adjust start and stop codon lists if needed.
- Choose whether incomplete ORFs should be included.
- Choose whether overlaps should remain visible.
- Click Find ORFs to generate results.
- Review the summary cards, Plotly graph, and ORF table.
- Export the detected ORFs as CSV or PDF.
Frequently Asked Questions
1) What is an ORF?
An open reading frame is a stretch of DNA that starts with a start codon and continues in-frame until a stop codon or sequence end.
2) Does this tool scan all reading frames?
Yes. It checks three frames on the forward strand, three on the reverse strand, or only the strand direction you choose.
3) Can I use FASTA input?
Yes. FASTA headers are ignored automatically, and the sequence is cleaned before analysis so pasted records work smoothly.
4) Can I define custom start codons?
Yes. Enter one or more custom start codons, separated by commas, spaces, or semicolons, to match alternative translation rules.
5) What happens when I disable terminal stop requirement?
The tool can report incomplete ORFs that extend to the end of the readable frame when no valid in-frame stop codon is found.
6) Why are overlapping ORFs important?
Some genomes contain nested or overlapping coding candidates. Keeping them visible helps exploratory screening before downstream validation.
7) Does this prove a region is a real gene?
No. ORF detection highlights coding candidates, but real gene confirmation needs annotation evidence, conservation, expression, or experimental validation.
8) What do the CSV and PDF exports contain?
Both exports include the detected ORF table. The PDF also includes key summary metrics for easier reporting and sharing.