Primer Design Inputs
Example Data Table
| Example Pair | Forward Primer | Reverse Primer | Amplicon | GC Range | Tm Range |
|---|---|---|---|---|---|
| Example A | ATGACCTGATCGTACGTTAG | CTAGCTACGGTCAGGTACGA | 124 bp | 45–55% | 58–62 °C |
| Example B | GCTAACCGTACCGATCGTAG | CGATCGGTAAGCTAGCTACG | 146 bp | 50–60% | 60–64 °C |
| Example C | TGACCTAGGCTAACCGTTAG | TAGCTAGCATCGATCGGTAA | 162 bp | 40–50% | 56–61 °C |
Formula Used
GC percentage: GC% = ((G + C) / primer length) × 100.
Wallace melting estimate: Tm = 2 × (A + T) + 4 × (G + C). This works well for short primer screening.
Salt-adjusted melting estimate: Tm = 81.5 + 16.6 × log10[Na+] + 0.41 × GC% − 600 / length, with sodium entered in molar units after conversion from mM.
GC clamp: the calculator counts G and C bases inside the last five bases at the 3′ end.
Homopolymer control: the longest repeated base run is measured to reduce slippage risk.
Heuristic pair score: the tool penalizes Tm mismatch, edge distance, extreme GC, self-complementarity, hairpin tendency, and amplicon distance from the target midpoint.
Primer concentration field: it is recorded for workflow planning, while candidate ranking uses the salt-adjusted screening model above.
How to Use This Calculator
- Paste a clean DNA template or FASTA sequence.
- Set primer length, GC, and melting temperature limits.
- Define the desired amplicon range and search windows.
- Choose whether a 3′ GC clamp is required.
- Click Design Primers to screen candidate pairs.
- Review the best pair summary, candidate table, and Plotly chart.
- Export the current shortlist as CSV or PDF when needed.
Frequently Asked Questions
1. What does this primer design calculator actually do?
It screens forward and reverse primer candidates from a template sequence, filters them by GC, Tm, homopolymer runs, clamp presence, and amplicon length, then ranks matching pairs with a practical scoring rule.
2. Does the tool accept FASTA input?
Yes. It ignores FASTA header lines, removes spaces and line breaks, converts RNA U bases to T, and keeps only standard A, C, G, and T characters.
3. Why are there two melting temperature values?
The Wallace estimate is a fast rule for short oligos. The salt-adjusted value better reflects ionic conditions, so the calculator uses that adjusted estimate for filtering and ranking.
4. What is a GC clamp and why does it matter?
A GC clamp means the primer ends with at least one G or C near the 3′ end. That often improves terminal binding stability during PCR extension without making the primer excessively sticky.
5. Why did the calculator return no valid primer pairs?
Your Tm, GC, amplicon, or search window settings may be too restrictive. Widen the limits slightly, allow longer search windows, or reduce clamp strictness to uncover more candidates.
6. Can I use these results directly for wet-lab work?
This is a strong screening step, but wet-lab validation is still essential. Check specificity against the intended genome, confirm secondary structure with dedicated tools, and verify product behavior experimentally.
7. How is self-complementarity handled here?
The calculator estimates contiguous complement matches against the reverse complement and also checks simple hairpin stem length. Higher values raise the pair penalty or remove unsuitable candidates.
8. What export options are included?
You can download the ranked pair table as CSV for spreadsheets or as PDF for reports. The exported file reflects the current results shown on the page.