DNA Fragment Calculator
Formula Used
Single strand mass:
MWss = Sum of nucleotide residue masses + terminal adjustment + salt correction.
Double strand mass:
MWds = MW of entered strand + MW of complementary strand.
Salt correction:
Salt addition = phosphate count x replacement ion mass difference.
Amount conversion:
pmol = ng x 1000 / molecular weight.
Concentration conversion:
nM = pmol / volume in uL x 1000.
The calculator uses average or monoisotopic DNA residue masses. Terminal corrections estimate unphosphorylated or 5 prime phosphorylated ends. Sodium and potassium settings add counterion mass to calculated phosphate groups.
How to Use This Calculator
- Paste the DNA sequence into the sequence box.
- Leave the sequence blank when only length is known.
- Select single stranded or double stranded DNA.
- Choose average or monoisotopic residue masses.
- Select terminal phosphorylation and salt correction settings.
- Enter sample amount and final volume.
- Press the calculate button.
- Download CSV or PDF after results appear.
Example Data Table
| Example | Input | Type | Settings | Expected Use |
|---|---|---|---|---|
| Short primer | ATGCGTACGTAGCTAGCTA | Single strand | Average, unphosphorylated, neutral | Primer stock planning |
| PCR product | 750 bp, 50% GC | Double strand | Average, unphosphorylated, sodium | Cloning insert mass |
| Library fragment | ACTGACTGACTGACTGACTGACTG | Double strand | Monoisotopic, phosphorylated, potassium | Exact mass review |
| GC rich insert | 1200 bp, 68% GC | Double strand | Average, unphosphorylated, neutral | Restriction digest setup |
Advanced DNA Fragment Mass Review
Why Sequence Matters
DNA fragments look simple, yet their mass changes with sequence, strand count, and chemical form. A short AT rich fragment weighs less than a GC rich fragment of the same length. That happens because each nucleotide has its own average residue mass. This calculator helps convert a pasted sequence, or a length based estimate, into a useful molecular weight report.
How The Tool Reads Input
The tool first cleans the entered bases. It keeps A, T, G, C, and converts U to T for convenience. It then counts bases and builds a complementary strand when double stranded DNA is selected. If no sequence is entered, the length and GC percentage estimate the base counts. This supports fast planning before a final sequence is available.
Mass Corrections
Molecular weight is calculated by summing nucleotide residue masses. Average masses are useful for routine laboratory work. Monoisotopic masses are helpful for exact mass review. Terminal settings adjust for unphosphorylated or phosphorylated strand ends. Salt correction can add sodium or potassium counterions to phosphate groups, which is useful when comparing dried material, supplier data, or mass spectrometry notes.
Concentration Planning
The concentration section turns a measured amount into pmol, fmol per microliter, and nanomolar values. These outputs help with ligation setup, cloning reactions, qPCR standards, sequencing libraries, and gel loading plans. The extinction estimate also gives an approximate micrograms per optical density unit in one milliliter. It should be treated as a planning estimate because true absorbance depends on sequence context and measurement conditions.
Lab Record Use
Use the result as a technical guide, not as a certificate. Real samples may include water, salts, dyes, labels, damaged bases, or mixed fragment populations. For regulated work, confirm the chemistry specification from the supplier or instrument method. Still, this calculator gives a transparent workflow. It shows the counts, formula choices, correction terms, and conversion steps in one report. The CSV and PDF buttons make it easier to archive the calculation or share it with a lab record. For best accuracy, paste the exact strand in the same direction used by your assay. Check ambiguous letters before submission. Review strand choice carefully, because single stranded and double stranded results differ greatly. Save exported files with the project name, sample date, and operator initials for easier traceability during later review.
FAQs
What is DNA fragment molecular weight?
It is the mass of one mole of the DNA fragment. The value is usually reported in daltons or grams per mole.
Can I calculate mass without a sequence?
Yes. Enter fragment length and GC percentage. The calculator estimates base counts, then calculates an approximate molecular weight.
Should I choose single or double stranded DNA?
Choose single stranded for primers or oligos. Choose double stranded for PCR products, plasmid fragments, restriction inserts, and most linear DNA fragments.
What does salt correction mean?
Salt correction adds counterion mass to phosphate groups. It helps compare neutral acid form, sodium salt form, or potassium salt form values.
Why does GC percentage affect molecular weight?
G and C residues have different masses than A and T residues. A GC rich fragment can weigh more than an AT rich fragment.
What is the terminal adjustment?
Terminal adjustment estimates chemical differences at strand ends. The calculator includes options for unphosphorylated and 5 prime phosphorylated ends.
Are OD260 values exact?
No. OD260 values are planning estimates. True absorbance depends on sequence context, purity, buffer, path length, and instrument calibration.
Can I export the calculation?
Yes. After calculation, use the CSV button for spreadsheet records or the PDF button for a printable report.