Primer Annealing Temperature Calculator

Paste primer sequences and choose your model. See Tm, GC percent, and suggested annealing range. Download tables as CSV or clean PDF summaries instantly.

Calculator

Allowed: A, C, G, T (U accepted and converted).
Enter the 5'→3' primer as written.
These are approximations; validate experimentally.
Used for a simple log correction.
Recommended: 3–5°C below the lower Tm.
Shown in the report; not used in formulas.
Reset

Example Data Table

Forward primer Reverse primer Method Na+ (mM) Offset (°C) Recommended Ta (°C)
AGTCCGATCGTACGATC TCGATGCTAGCTAGGCTA Auto 50 3 ~55–59
GCGTACGATGCTAGCTAGCTA CGATCGTACGTAGCTAGCATG GC-count long 50 4 ~58–62
ATGCTAGCTAGCTAGCTA TAGCTAGCTAGCATGCTA Basic %GC 100 5 ~52–56

Values are illustrative; actual conditions depend on polymerase, buffer, additives, and template complexity.

Formulas Used

These are simplified estimates intended for quick planning. For high-precision design, consider nearest-neighbor thermodynamics and your exact buffer composition.

How to Use This Calculator

  1. Paste your forward and reverse primer sequences (5'→3').
  2. Select a melting model or keep Auto for convenience.
  3. Enter Na+ concentration and an annealing offset (3–5°C typical).
  4. Click Calculate to see Tm values and a suggested Ta range.
  5. Download CSV for spreadsheets or PDF for lab notes.

FAQs

1) What annealing temperature should I start with?

A practical start is 3–5°C below the lower primer Tm. Run a gradient PCR around the suggested range to find the best specificity and yield.

2) Which Tm method should I choose?

Use Wallace for very short primers, and the long-oligo approximation for typical 18–30 nt primers. If you need a second check, compare methods and choose a conservative Ta.

3) Why does salt concentration affect Tm?

Higher ionic strength stabilizes duplex formation by shielding phosphate charges, increasing Tm. The built-in correction is rough, so treat it as guidance rather than a guarantee.

4) Can I paste primers with spaces or lowercase letters?

Yes. The calculator removes whitespace, converts to uppercase, and turns RNA “U” into “T”. Non-DNA characters are stripped for safer counting.

5) What GC percent is considered healthy?

Many primers work well around 40–60% GC, but this varies by target. Extreme GC can raise Tm and promote secondary structures, while very low GC can reduce binding stability.

6) Does amplicon length change annealing temperature?

Annealing temperature depends mainly on primer binding, not product size. However, longer products may need longer extension times and optimized cycling conditions.

7) Are these results accurate enough for publication-grade design?

They are best for quick estimates and planning. For critical assays, use nearest-neighbor thermodynamics, include Mg2+ and additives, and validate with a PCR gradient and melt-curve checks.

Related Calculators

volume distribution calculator

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.