Calculator
Example Data Table
| Forward primer | Reverse primer | Method | Na+ (mM) | Offset (°C) | Recommended Ta (°C) |
|---|---|---|---|---|---|
| AGTCCGATCGTACGATC | TCGATGCTAGCTAGGCTA | Auto | 50 | 3 | ~55–59 |
| GCGTACGATGCTAGCTAGCTA | CGATCGTACGTAGCTAGCATG | GC-count long | 50 | 4 | ~58–62 |
| ATGCTAGCTAGCTAGCTA | TAGCTAGCTAGCATGCTA | Basic %GC | 100 | 5 | ~52–56 |
Values are illustrative; actual conditions depend on polymerase, buffer, additives, and template complexity.
Formulas Used
- Wallace rule: Tm = 2×(A+T) + 4×(G+C)
- GC-count long approximation: Tm = 64.9 + 41×((G+C − 16.4)/N)
- Basic %GC approximation: Tm = 81.5 + 0.41×(%GC) − (675/N)
- Salt correction (rough): Tm(adj) = Tm + 16.6×log10([Na+]) where [Na+] is in mol/L
- Annealing recommendation: Ta = min(Tm(adj)) − offset; range = Ta ± 2°C
These are simplified estimates intended for quick planning. For high-precision design, consider nearest-neighbor thermodynamics and your exact buffer composition.
How to Use This Calculator
- Paste your forward and reverse primer sequences (5'→3').
- Select a melting model or keep Auto for convenience.
- Enter Na+ concentration and an annealing offset (3–5°C typical).
- Click Calculate to see Tm values and a suggested Ta range.
- Download CSV for spreadsheets or PDF for lab notes.
FAQs
1) What annealing temperature should I start with?
A practical start is 3–5°C below the lower primer Tm. Run a gradient PCR around the suggested range to find the best specificity and yield.
2) Which Tm method should I choose?
Use Wallace for very short primers, and the long-oligo approximation for typical 18–30 nt primers. If you need a second check, compare methods and choose a conservative Ta.
3) Why does salt concentration affect Tm?
Higher ionic strength stabilizes duplex formation by shielding phosphate charges, increasing Tm. The built-in correction is rough, so treat it as guidance rather than a guarantee.
4) Can I paste primers with spaces or lowercase letters?
Yes. The calculator removes whitespace, converts to uppercase, and turns RNA “U” into “T”. Non-DNA characters are stripped for safer counting.
5) What GC percent is considered healthy?
Many primers work well around 40–60% GC, but this varies by target. Extreme GC can raise Tm and promote secondary structures, while very low GC can reduce binding stability.
6) Does amplicon length change annealing temperature?
Annealing temperature depends mainly on primer binding, not product size. However, longer products may need longer extension times and optimized cycling conditions.
7) Are these results accurate enough for publication-grade design?
They are best for quick estimates and planning. For critical assays, use nearest-neighbor thermodynamics, include Mg2+ and additives, and validate with a PCR gradient and melt-curve checks.