Primer Tm Calculator

Check primer Tm, GC balance, and risk notes today. Compare methods fast before ordering primers. Design cleaner PCR primers for safer lab decisions now.

Calculate Tm of Primers

nM
mM
mM
mM
°C
bp

Example Data Table

Primer Sequence Length GC Content Estimated Tm
Example A ATGCGTACGTTAGCTAGCTA 20 50% About 55 °C
Example B GCGTACGGCATCGTACGCTA 20 60% About 59 °C
Example C ATATGCTAGTACATGCTACA 20 40% About 51 °C

Formula Used

Wallace rule: Tm = 2 × (A + T) + 4 × (G + C).

Basic long primer estimate: Tm = 64.9 + 41 × (GC count − 16.4) ÷ primer length.

Salt adjusted estimate: Tm = 81.5 + 16.6 × log10(salt molarity) + 0.41 × GC% − 675 ÷ primer length − mismatch penalty.

The effective salt value includes monovalent salt and a simple magnesium adjustment. These formulas are estimates. Laboratory validation is still required.

How to Use This Calculator

  1. Enter a primer name for easy reporting.
  2. Paste a DNA primer sequence using A, T, G, and C bases.
  3. Select a calculation method, or keep the automatic option.
  4. Enter salt, magnesium, dNTP, and mismatch values if known.
  5. Press the calculate button.
  6. Review Tm, GC content, annealing temperature, and design notes.
  7. Use CSV or PDF download for record keeping.

Primer Melting Temperature Guide

Primer melting temperature helps predict stable binding during PCR setup. It is the temperature where half of the primer duplex is paired. A good estimate supports cleaner amplification. It also helps compare forward and reverse primers before synthesis.

Why Primer Tm Matters

PCR works best when primer pairs have similar melting values. Large gaps can cause weak bands, nonspecific products, or primer dimers. Many routine assays keep both primers within a narrow range. The final annealing temperature is usually set a few degrees below the lower primer value.

What This Calculator Checks

This calculator accepts DNA primer sequences using A, T, G, and C bases. It removes spaces and line breaks. It reports length, GC content, AT content, molecular weight, salt adjusted melting temperature, and suggested annealing temperature. It also gives simple risk notes for GC clamp strength, short primers, long primers, and possible self complementarity.

Choosing A Formula

Short primers can be reviewed with the Wallace rule. That method counts A and T as two degrees. It counts G and C as four degrees. Longer primers often need a salt adjusted estimate. The salt method uses primer length, GC percent, and monovalent ion concentration. This page also lets you compare both methods side by side.

Reading The Result

A balanced primer often has moderate GC content and a reasonable length. Many primers fall between eighteen and thirty bases. GC content near forty to sixty percent is common. Very high GC content can raise melting values and increase secondary structure. Very low GC content can reduce binding strength.

Practical Design Tips

Use the result as a screening estimate. Confirm critical assays with laboratory software or validated protocols. Avoid long runs of one base. Check both primers together. Compare product size, template complexity, and reaction chemistry. Magnesium, additives, probes, mismatches, and modified bases can change real performance.

Best Use Case

The tool is useful for teaching, quick planning, and early primer review. It is not a replacement for experimental validation. It gives a transparent calculation. It also shows assumptions clearly. That makes it easier to explain results to students, coworkers, or clients before final primer ordering. Document selected settings so later assay reviews remain consistent and clear.

FAQs

What is primer Tm?

Primer Tm is the estimated melting temperature of a primer-template duplex. It helps choose a suitable PCR annealing temperature.

Which formula should I use?

Use the automatic option for quick screening. It applies Wallace for short primers and salt adjustment for longer primers.

What GC content is usually preferred?

Many routine primers work well around 40% to 60% GC content. Exact needs depend on template and assay conditions.

What is a GC clamp?

A GC clamp means G or C bases near the 3 prime end. It can improve binding stability when not excessive.

Why does salt affect Tm?

Salt shields DNA backbone charges. Higher salt often stabilizes duplex formation and raises estimated melting temperature.

Can this replace lab validation?

No. This calculator gives screening estimates. Final primer performance should be confirmed with experiments or validated design tools.

Why is my primer flagged as risky?

Risk notes may appear for low GC, high GC, odd length, base runs, weak clamp, or possible self complementarity.

Can I use RNA primers here?

This page is designed for DNA primers. RNA, modified bases, probes, and degenerate bases need specialized formulas.

Related Calculators

Paver Sand Bedding Calculator (depth-based)Paver Edge Restraint Length & Cost CalculatorPaver Sealer Quantity & Cost CalculatorExcavation Hauling Loads Calculator (truck loads)Soil Disposal Fee CalculatorSite Leveling Cost CalculatorCompaction Passes Time & Cost CalculatorPlate Compactor Rental Cost CalculatorGravel Volume Calculator (yards/tons)Gravel Weight Calculator (by material type)

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.