NEB Phusion Tm Calculator

Estimate Phusion primer Tm with practical PCR guidance. Compare primers, GC balance, and annealing choices. Download clear reports for lab notes and records today.

Calculator Form

Only A, T, G, C, and U are used. U is treated as T. Exclude nonbinding overhangs for binding Tm.

Example Data Table

Forward Primer Reverse Primer Amplicon bp Forward Tm Reverse Tm Suggested Ta
ATGGCTACGTTAGCATTGAC GTCAATGCTAACGTAGCCAT 1000 46.42 °C 46.42 °C 49.42 °C
GCTAGCTGACCTGATCGTGA TCACGATCAGGTCAGCTAGC 750 49.82 °C 49.82 °C 52.82 °C
ATATGCGCGTATATGCGCAT ATGCGCATATACGCGCATAT 1500 48.47 °C 48.47 °C 51.47 °C

Formula Used

GC percent: GC% = (G + C) / primer length × 100.

Wallace rule: Tm = 2 × (A + T) + 4 × (G + C). This is best for short primers.

GC adjusted formula: Tm = 81.5 + 16.6 log10 salt + 0.41 GC% − 675 / length.

Nearest-neighbor estimate: Tm = ΔH / (ΔS + R ln concentration) with salt and DMSO adjustment.

DMSO correction: adjusted Tm = calculated Tm − 0.6 × DMSO percent.

Phusion annealing estimate: if both primers are at least 20 bases, Ta = lower Tm + 3 °C. If either primer is shorter, Ta = lower Tm.

This page is an educational estimator. Confirm final reaction conditions with validated laboratory guidance and gradient PCR.

How to Use This Calculator

  1. Paste the forward primer in the 5′ to 3′ direction.
  2. Paste the reverse primer in the 5′ to 3′ direction.
  3. Choose the Tm method or keep Auto selected.
  4. Enter primer concentration, salt, DMSO, and amplicon length.
  5. Press Calculate to see the result below the header.
  6. Review Tm, GC content, warnings, and annealing guidance.
  7. Download CSV or PDF for your records.

About This Calculator

This calculator helps you estimate primer melting temperature for Phusion based PCR planning. It is built for quick laboratory checks before gradient testing. The tool accepts forward and reverse primers in the 5 prime to 3 prime direction. It removes spaces and common marks. Then it counts bases, length, GC percentage, and simple risk signals.

Why Tm Matters

Primer melting temperature shows the point where half of the primer duplex is expected to separate. A good annealing setting supports specific binding. A poor setting can cause weak bands, nonspecific bands, or no product. Phusion reactions often use higher annealing temperatures than many standard polymerase systems. That is why a dedicated estimate is useful.

What The Result Shows

The result panel reports Tm for each primer and selects the lower value. It then gives a recommended annealing temperature. For primers of 20 bases or more, the tool adds 3 degrees to the lower Tm. For shorter primers, it keeps the lower Tm as the starting point. The gradient range gives a practical window for optimization.

Primer Quality Checks

The calculator also flags primer length, GC content, homopolymer runs, and a simple self complement score. These checks do not replace full primer design software. They help you see possible issues early. A balanced primer often has moderate GC content, a useful 3 prime clamp, and no long repeated base run.

Export And Records

CSV export is useful for spreadsheets and lab notebooks. The PDF button creates a simple report for sharing or archiving. Keep exported records with template names, reaction mix, buffer choice, cycle setup, and gel results. This habit makes troubleshooting easier.

Practical Use

Start with clean primer sequences. Exclude nonbinding overhangs when estimating binding Tm. Enter final primer concentration, salt level, DMSO percentage, and amplicon length. Review warnings before ordering primers or running PCR. Always confirm demanding assays with a gradient. For difficult GC rich templates, secondary structure, or long amplicons, adjust cycling conditions carefully. Use this page as a planning aid, not as a final experimental guarantee. Document failed reactions too, because negative results show which temperatures, additives, or cycle times should be avoided during the next planned experiment with similar primer sets later on safely.

FAQs

What is a Phusion Tm calculator?

It estimates primer melting temperature and a starting annealing temperature for Phusion PCR planning. It also checks GC content, primer length, and simple design risks.

Is this the official NEB calculator?

No. This is an independent educational estimator. Use official product guidance and experimental validation before finalizing important laboratory work.

Which primer direction should I enter?

Enter both primers in the 5′ to 3′ direction. Do not reverse complement the reverse primer before entering it.

Should I include cloning overhangs?

For binding Tm, use only the primer region that binds the template. Extra nonbinding tails can raise the apparent Tm incorrectly.

Why is DMSO included?

DMSO can lower primer melting temperature. The calculator uses a simple correction of 0.6 °C per DMSO percent.

What GC content is preferred?

Many primers work well near 40% to 60% GC content. Very low or very high GC can need more optimization.

What does self complement score mean?

It is a quick warning for possible primer self pairing. High values may suggest dimers or hairpin related problems.

Can I download the result?

Yes. Use the CSV button for spreadsheet data. After calculating, use the PDF button for a simple report.

Related Calculators

Paver Sand Bedding Calculator (depth-based)Paver Edge Restraint Length & Cost CalculatorPaver Sealer Quantity & Cost CalculatorExcavation Hauling Loads Calculator (truck loads)Soil Disposal Fee CalculatorSite Leveling Cost CalculatorCompaction Passes Time & Cost CalculatorPlate Compactor Rental Cost CalculatorGravel Volume Calculator (yards/tons)Gravel Weight Calculator (by material type)

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.