NEB Tm Q5 Calculator

Calculate primer Tm, GC content, and Q5 annealing fast. Review pair balance before setting cycles. Save neat CSV and PDF reports for notes today.

View, CSV download, and PDF download.

Example Data Table

Input Example Value Purpose
Forward primer AGCGGATAACAATTTCACACAGGA Primer one Tm check
Reverse primer CCTCACTAAAGGGAACAAAAGCTG Primer two Tm check
Salt 50 mM Salt correction input
Magnesium 2 mM Effective salt support
Amplicon 1000 bp Extension estimate

Formula Used

GC percentage: GC% = (G + C) / primer length × 100.

Wallace Tm: Tm = 2(A + T) + 4(G + C). This is used for short primers.

Salt adjusted Tm: Tm = 81.5 + 16.6 log10([salt]) + 0.41(GC%) - 675 / length.

Q5 guidance: Suggested annealing = lower primer Tm + 3 °C when the Q5 option is checked.

Extension estimate: extension seconds = amplicon length in kb × selected seconds per kb.

How to Use This Calculator

Enter the forward primer first. Add the reverse primer for pair analysis. Set salt, magnesium, primer concentration, and amplicon length. Keep the Q5 option checked for Q5 planning. Press Calculate. Read the result above the form. Download CSV or PDF when you need a record.

Primer Tm Planning for Q5 Workflows

A Q5 primer set needs careful temperature planning. Small changes can affect yield, specificity, and clean band formation. This calculator gives a structured estimate for daily PCR setup. It checks each primer sequence, removes spacing, and accepts only A, T, G, and C bases. It then reports length, base counts, GC percentage, Wallace Tm, salt adjusted Tm, primer balance, and a suggested annealing range.

Why This Calculator Helps

Primer pairs often look acceptable by eye. Still, one primer may be much richer in GC bases. Another may be too short, too long, or poorly matched with its partner. The tool highlights those differences before a reaction is prepared. It also gives a pair average and the lower primer Tm. That lower value is important because the weaker primer often limits annealing.

Formula Logic

The short primer estimate uses the Wallace rule. It adds two degrees for each A or T base. It adds four degrees for each G or C base. The longer estimate uses a simple salt correction. It combines GC percentage, sequence length, and monovalent salt level. This is not a replacement for a validated lab protocol. It is a screening aid for fast planning and record keeping.

Using the Results

Start by entering the forward primer. Add the reverse primer when you want pair guidance. Set primer concentration and salt values to match your reaction notes. Choose whether to include a Q5 adjustment. Press Calculate. The result appears above the form. Review the warning notes before using the suggested temperature.

Good PCR Practice

A calculated value should not be treated as final proof. Run a gradient when the template is difficult, GC rich, or very long. Use the cleanest primer pair you can design. Avoid strong primer dimers. Keep notes for every run. Download the CSV file for spreadsheets. Download the PDF file for a compact report. Together, these records make troubleshooting easier and faster.

Practical Notes

Use matched primers when possible. Keep both Tm values close. A difference above five degrees may need redesign. Check the full amplicon plan too. Extension time, template amount, cycle count, and additives can change performance. Clean calculations support better choices during routine PCR work.

FAQs

1. What does this calculator estimate?

It estimates primer Tm, GC content, primer balance, Q5 annealing temperature, and extension time. It is meant for planning and record keeping before lab confirmation.

2. Is this the official NEB tool?

No. It is a custom planning calculator. Use the official manufacturer calculator and your lab protocol when final accuracy is required.

3. Why is the lower Tm important?

The lower Tm primer often controls annealing. If one primer binds weakly, the pair may perform poorly even when the other primer looks strong.

4. What GC range is preferred?

Many primer checks prefer about 40% to 60% GC content. Values outside that range may still work, but they deserve closer review.

5. Why add 3 degrees for Q5 guidance?

Q5 workflows often use a higher annealing setting than basic Taq style estimates. This option applies that planning adjustment to the lower primer Tm.

6. Can I use only one primer?

Yes. Enter only the forward primer to estimate its sequence properties. Add the reverse primer when you need pair difference and lower Tm guidance.

7. What does the PDF download include?

The PDF report includes primer sequences, Tm values, GC content, annealing guidance, extension estimate, and a short method note.

8. Should I still run a gradient?

Yes, especially for GC rich templates, long targets, weak bands, or new primer sets. A gradient helps confirm the best real reaction temperature.

Related Calculators

Paver Sand Bedding Calculator (depth-based)Paver Edge Restraint Length & Cost CalculatorPaver Sealer Quantity & Cost CalculatorExcavation Hauling Loads Calculator (truck loads)Soil Disposal Fee CalculatorSite Leveling Cost CalculatorCompaction Passes Time & Cost CalculatorPlate Compactor Rental Cost CalculatorGravel Volume Calculator (yards/tons)Gravel Weight Calculator (by material type)

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.