PCR Primer Tm Calculator

Forward primer sequence

Reverse primer sequence

Tm method

Primer concentration

Monovalent salt

Magnesium

Total dNTP

Annealing offset from lower Tm

°C

Amplicon length

Example Data Table

Primer	Sequence	Length	GC %	Expected Use
Forward	ATGCGTACCTGACTGATCGA	20	50	Routine PCR screen
Reverse	TCGATCAGTCAGGTACGCAT	20	50	Matched primer pair
GC rich	GCGTCCGACGGTACCGTCTA	20	65	Needs review

Formula Used

Wallace rule: Tm = 2 × (A + T) + 4 × (G + C). A salt shift is added for practical comparison.

GC salt method: Tm = 100.5 + 41 × GC fraction − 820 / length + 16.6 × log10([Na equivalent]).

Sodium equivalent: [Na equivalent] = [Na] + 120 × square root of free magnesium. Free magnesium equals magnesium minus dNTP.

Nearest neighbor method: Tm = ΔH / (ΔS + R × ln(Ct / 4)) − 273.15. Salt correction is applied to entropy.

Annealing estimate: suggested annealing temperature = lower selected primer Tm + selected offset.

How to Use This Calculator

Paste the forward primer sequence.
Paste the reverse primer sequence when available.
Enter primer concentration and reaction salt values.
Select a Tm method or keep automatic mode.
Set the annealing offset, often between -3 and -5 °C.
Press calculate and review the result above the form.
Export the report with CSV or PDF.

PCR Primer Tm Calculator Guide

Why Primer Tm Matters

Primer melting temperature shows when half of a primer binds its matching template. It guides annealing temperature. A good value improves yield, specificity, and repeatability. Low Tm can allow loose binding. Very high Tm can reduce extension efficiency. Balanced primer pairs usually differ by less than two degrees.

What This Tool Checks

This calculator reviews forward and reverse primers together. It cleans spaces, line breaks, and lowercase letters. It counts bases, length, GC content, and GC clamp strength. It also estimates salt corrected Tm with a nearest neighbor model. The Wallace value is shown for quick screening. The long primer value is shown for comparison.

Good Primer Design Targets

Most PCR primers work well at eighteen to twenty five bases. GC content often falls between forty and sixty percent. The final five bases should include one or two G or C bases. Avoid long single base runs. Avoid very strong self matching near the three prime end. Pair primers with similar Tm values. Keep amplicon length suitable for the polymerase and cycling plan.

Using The Results

Enter each primer in the form. Add monovalent salt, magnesium, dNTP, and primer concentration values from your reaction. Select the preferred method or leave automatic mode. Press calculate. The result appears above the form. Use the lower primer Tm to choose a starting annealing temperature. Many protocols begin three to five degrees below that value. A gradient run can refine the final setting.

Reading Warnings

Warnings are not absolute failures. They mark features that deserve review. A primer with high GC may still work with additives. A short primer may work for screening. A large Tm gap may require redesign. Treat warnings as design signals, not final lab rules.

Exporting Reports

Download the CSV file for records or batch notes. Use the PDF button for a printable summary. Keep exported data with primer orders, template notes, and cycling settings. This helps troubleshooting later. It also makes repeated assays easier to compare.

Practical Notes

Use nuclease free water for dilutions. Confirm sequence orientation before ordering. Check templates for known variants. Recalculate when reaction chemistry changes. Small input changes can shift the recommended annealing range for setup.

FAQs

What is primer Tm?

Primer Tm is the temperature where half of the primer is bound to its matching strand. It helps choose the PCR annealing temperature.

Which Tm method should I use?

Use automatic mode for routine work. It uses Wallace for short primers and nearest neighbor for longer primers.

Why does salt affect Tm?

Salt stabilizes DNA duplexes. Higher salt often raises melting temperature. Magnesium can have a strong effect in PCR buffers.

What is a good primer length?

Many PCR primers are 18 to 25 bases long. Shorter primers may bind loosely. Longer primers may raise Tm too much.

What GC content is preferred?

A common target is 40% to 60% GC. This range often gives stable binding without excessive duplex strength.

What is a GC clamp?

A GC clamp means G or C bases near the three prime end. One or two can improve stable extension starts.

How close should primer pair Tm values be?

Try to keep forward and reverse primer Tm values within two degrees. Larger gaps can reduce amplification consistency.

Can this replace lab validation?

No. It provides design estimates. Confirm primer performance with gradient PCR, controls, and assay-specific optimization.