Phusion NEB Tm Calculator

Calculate primer Tm, GC balance, and annealing estimates. Check sequence quality before setting cycle plans. Plan timing with useful PCR notes for every run.

Calculator Form

Example Data Table

Example Forward Primer Reverse Primer Product Length DMSO Expected Use
Standard amplicon ATGGCTAGCTACGACTACGATCG CGATCGTAGTCGTAGCTAGCCAT 1000 bp 0% Routine Phusion planning
GC rich check GCGTACCGGATCGGCTACGA TCGTAGCCGATCCGGTACGC 750 bp 3% Addon effect review
Short product ATGACCTGATCGTACGAT ATCGTACGATCAGGTCAT 250 bp 0% Fast screening setup

Formula Used

This calculator uses a transparent planning estimate. It is not the official thermodynamic model.

How To Use This Calculator

  1. Enter the forward and reverse primer names.
  2. Paste primer sequences using A, T, G, and C characters.
  3. Add salt, magnesium, DMSO, and product length values.
  4. Press Calculate to show the result above the form.
  5. Review the Tm gap, GC balance, clamp count, and notes.
  6. Download the result as CSV or PDF when needed.
  7. Confirm final conditions with a temperature gradient experiment.

Phusion Primer Planning Guide

Phusion reactions need careful primer temperature planning. A primer binds during the annealing step. If the value is too low, unwanted binding can occur. If it is too high, yield may fall. This calculator gives a clear estimate for routine planning. It checks both primer sequences and shows a suggested annealing temperature. It also lists GC balance, length, base counts, extension timing, and simple design notes.

Why Tm Matters

Melting temperature describes the point where half of a primer duplex is separated. PCR uses that value to choose a practical annealing setting. Phusion enzymes often work best with a high and specific annealing temperature. The lower primer value normally controls the pair. Matching both primers closely makes setup easier. A wide gap can cause weak amplification or nonspecific products.

What This Tool Checks

The form accepts forward and reverse primer sequences. It removes spaces and line breaks. It then validates the remaining bases. The calculator counts A, T, G, and C. It reports GC percentage and an estimated melting value for each primer. It also checks the last five bases for a GC clamp. A modest clamp can improve priming. Too many G or C bases at the end can increase mispriming risk.

Using The Estimate

Use the result as a planning guide. For longer primers, the suggested Phusion annealing value is based on the lower primer estimate plus an offset. For short primers, the lower estimate is used more directly. DMSO lowers the displayed estimate. Magnesium and salt raise the effective ionic strength. These adjustments are simplified. A gradient PCR is still useful when yield or specificity is uncertain.

Good Primer Habits

Keep most primers between eighteen and thirty bases. Aim for balanced GC content. Avoid long single-base runs. Check the target sequence before ordering primers. Confirm that added tails, restriction sites, or mutations are excluded when calculating the matched region. Review the product length and extension time together. Longer amplicons need more time. Final results should always be confirmed experimentally.

When To Recheck

Recheck values after changing buffers, additives, or primer concentration. Recheck again when primers include ambiguous bases. Small edits can shift design quality. Document each run to improve future PCR choices well.

FAQs

What does this calculator estimate?

It estimates primer Tm, GC content, annealing temperature, and extension time. It is meant for planning Phusion reaction setup, not replacing laboratory optimization.

Can I use ambiguous bases?

The calculator only accepts A, T, G, and C for estimates. Other characters are ignored and flagged in the primer notes.

Why is the lower primer Tm important?

The lower primer Tm usually limits the pair. Setting annealing too high may weaken that primer and reduce product yield.

Why does DMSO reduce the result?

DMSO can lower duplex stability. The calculator applies a simple correction so GC rich or additive based reactions are easier to compare.

What GC content is usually useful?

A common planning range is about forty to sixty percent. Values outside that range can still work, but they may need more testing.

What is a GC clamp?

A GC clamp is one or more G or C bases near the primer 3 prime end. A modest clamp can support stable priming.

Should I run a gradient PCR?

Yes, when the template is difficult, primers differ, or specificity is uncertain. A gradient helps find the best practical annealing temperature.

Does the PDF need an extra library?

No. This file creates a simple PDF directly. For styled laboratory reports, you can later connect a dedicated PDF library.

Related Calculators

Paver Sand Bedding Calculator (depth-based)Paver Edge Restraint Length & Cost CalculatorPaver Sealer Quantity & Cost CalculatorExcavation Hauling Loads Calculator (truck loads)Soil Disposal Fee CalculatorSite Leveling Cost CalculatorCompaction Passes Time & Cost CalculatorPlate Compactor Rental Cost CalculatorGravel Volume Calculator (yards/tons)Gravel Weight Calculator (by material type)

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.