Promega Tm Pfu Primers PCR Calculator

Plan Pfu primer pairs with balanced Tm values. Review GC, clamps, and annealing guidance quickly. Export practical PCR notes for cleaner laboratory decisions today.

Calculator

Formula Used

Wallace Tm: Tm = 2 × (A + T) + 4 × (G + C).

Salt adjusted Tm: Tm = 81.5 + 16.6 × log10([Na+]) + 0.41 × GC% − 675 ÷ primer length.

Long primer GC formula: Tm = 64.9 + 41 × ((G + C − 16.4) ÷ primer length).

Suggested annealing: lower primer Tm − selected offset.

Extension time: amplicon length in kb × selected seconds per kb. A minimum of 15 seconds is applied.

The magnesium option is an approximate planning adjustment. It should be checked against the final enzyme buffer and laboratory protocol.

How To Use This Calculator

  1. Paste the forward and reverse primer sequences.
  2. Select the Tm method. Auto mode is suitable for quick screening.
  3. Enter salt, magnesium, primer concentration, amplicon length, and cycle settings.
  4. Press Calculate to view the result above the form.
  5. Use CSV or PDF export for laboratory notes.

Example Data Table

Forward Primer Reverse Primer Amplicon Na+ Mg2+ Offset
ATGGCTACGTTGACCTGAAG TCAGGTCGATGACCTTGCTA 1000 bp 50 mM 1.5 mM 3 °C
GCTTACGACCTGATCGATGA TGACCGTAAGCTTGATCCAA 750 bp 50 mM 1.5 mM 4 °C

Primer Planning For Pfu PCR

Pfu polymerase is chosen when accuracy matters. It has proofreading activity and helps reduce copied errors. A strong reaction still starts with careful primer design. This calculator checks sequence length, GC ratio, melting temperature, primer balance, and extension time in one place.

Why Tm Matters

Melting temperature estimates how strongly a primer binds to its target. A primer pair should have close Tm values. Large differences can make one primer bind too early or too late. That can cause weak bands, extra bands, or no product. The lowest calculated Tm usually guides the annealing setting.

GC And End Checks

GC content affects binding strength. Many routine primers work well between forty and sixty percent GC. A small GC clamp near the three prime end may improve stable extension. Too many G or C bases at the end can also increase non-specific priming. Long homopolymer runs may create slippage and poor synthesis.

PCR Setup Guidance

The annealing temperature is an estimate, not a guarantee. Start a few degrees below the lower primer Tm. Then adjust with a gradient if bands are weak or messy. Longer amplicons need longer extension. The calculator multiplies product length by the selected seconds per kilobase. This gives a practical extension time for planning.

Laboratory Use

Use clean primer sequences with only A, C, G, and T. Remove spaces, labels, and direction marks before calculating. Review warnings before ordering primers. Check target specificity with a database search. Confirm product size from your template map. The result table can be saved as CSV or PDF for notes.

Important Limits

This tool uses common screening formulas and optional magnesium guidance. It is not a replacement for a vendor protocol or wet lab optimization. Salt, additives, template complexity, primer concentration, and cycler behavior can shift performance. Treat the output as a starting point. Verify every important assay with controls and a temperature gradient.

Result Review

When results look marginal, change one variable at a time. Shorten very long primers. Move a primer away from repeats. Raise annealing for extra bands. Lower annealing for missing bands. Record every trial. Good notes make later PCR troubleshooting much faster and easier during routine bench work and assay transfer.

FAQs

What does this calculator estimate?

It estimates primer Tm, GC content, annealing range, extension time, and pair balance for Pfu PCR planning. It is a screening aid, not a final validated protocol.

Can I use ambiguous bases?

No. This version accepts only A, C, G, and T. Ambiguous bases can change Tm and specificity, so the calculator asks for exact primer sequences.

Which Tm method should I choose?

Auto mode is useful for general screening. It uses Wallace for short primers and salt adjusted GC calculation for longer primers.

Why is magnesium optional?

Magnesium can raise apparent primer stability. The adjustment here is approximate. Final PCR behavior depends on buffer, template, additives, and enzyme instructions.

What Tm difference is acceptable?

A small difference is preferred. Many primer pairs work best when Tm values are within about 3°C, but validation is still needed.

What is a GC clamp?

A GC clamp is G or C content near the primer's three prime end. One to three GC bases in the last five bases is often useful.

How is extension time calculated?

The tool multiplies amplicon length in kilobases by your selected seconds per kilobase. It also applies a short minimum time.

Can I export the result?

Yes. Use the CSV button for spreadsheet records. Use the PDF button for a simple printable primer planning report.

Related Calculators

Paver Sand Bedding Calculator (depth-based)Paver Edge Restraint Length & Cost CalculatorPaver Sealer Quantity & Cost CalculatorExcavation Hauling Loads Calculator (truck loads)Soil Disposal Fee CalculatorSite Leveling Cost CalculatorCompaction Passes Time & Cost CalculatorPlate Compactor Rental Cost CalculatorGravel Volume Calculator (yards/tons)Gravel Weight Calculator (by material type)

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.