Q5 Polymerase Tm Calculator

Estimate Q5 primer Tm with practical lab options. Check GC, salts, DMSO, and annealing range. Export concise results for cleaner PCR planning every time.

Calculator Inputs

Example Data Table

Input Example Value Purpose
Forward Primer ATGGCTACGTTAGCTACGAT Calculates forward primer Tm
Reverse Primer CGTACGATCGTAGCTAGCAT Calculates reverse primer Tm
Primer Concentration 500 nM Adjusts thermodynamic temperature
Salt 50 mM Estimates ionic strength effect
DMSO 0% Applies solvent correction

Formula Used

For primers shorter than 14 bases, this calculator uses the Wallace rule: Tm = 2 × (A + T) + 4 × (G + C).

For longer primers, it uses a nearest-neighbor thermodynamic estimate. The basic calculation is Tm = ΔH / (ΔS + R × ln(Ct / 4)). It then converts Kelvin to Celsius.

Salt, magnesium, dNTP, DMSO, and Q5 adjustment values are applied after that. The suggested annealing range is estimated from the lower primer Tm. The default range is from Tm minus 3 °C to Tm.

This calculator is a planning tool. Confirm final annealing temperature with a gradient experiment.

How to Use This Calculator

Enter the forward and reverse primer sequences. Use only A, C, G, and T bases. Add the final primer concentration used in the reaction. Keep the value in nanomolar units.

Enter salt, magnesium, and dNTP levels. These values help estimate reaction ionic strength. Add DMSO only when your reaction includes it. The calculator reduces Tm for DMSO because it can lower duplex stability.

Press the calculate button. The result appears above the form. Review each primer Tm, GC percentage, molecular weight, and annealing range. Use the pair recommendation for initial PCR planning.

Download the CSV file for spreadsheet records. Download the PDF file for a compact lab report.

Q5 Primer Tm Planning Guide

Why Tm Matters

Primer melting temperature helps define a useful PCR annealing temperature. A poor estimate can reduce yield. It can also increase nonspecific bands. Q5 reactions often perform best with carefully selected annealing settings. This calculator gives a structured estimate before lab testing begins.

Primer Balance

A good primer pair should have similar Tm values. A wide difference can cause one primer to bind well before the other. Try to keep both primers within a few degrees. Also review GC content. Extremely low GC can weaken binding. Extremely high GC can increase secondary structure risk.

Reaction Conditions

Salt and magnesium change duplex stability. Higher ionic strength usually raises apparent Tm. DMSO often lowers Tm. It is useful for difficult or GC-rich templates. Because these effects are condition dependent, the calculator lets you adjust them directly.

Q5 Adjustment

The Q5 adjustment field lets you add an empirical correction. The default value is two degrees. You can change it when your protocol, buffer, or internal validation suggests another setting. This keeps the tool flexible for different workflows.

Using the Result

Start with the suggested pair annealing temperature. The displayed range gives a practical test window. For new primers, run a gradient when accuracy matters. Choose the temperature that gives a strong specific product. Keep notes about primer concentration, additives, and template quality. Those details make later troubleshooting easier.

Exporting Records

The CSV export is helpful for batch documentation. The PDF export is useful for quick sharing. Store the report with your PCR plan. This creates a clear record of assumptions used before optimization.

FAQs

1. What does this calculator estimate?

It estimates primer melting temperature, GC content, molecular weight, and a practical Q5 annealing range for PCR planning.

2. Is this a replacement for gradient PCR?

No. It gives a strong starting point. Final conditions should be confirmed with a gradient when precision matters.

3. Which bases are accepted?

The calculator accepts A, C, G, and T. Ambiguous bases are rejected to keep the estimate clear.

4. Why does DMSO reduce Tm?

DMSO can weaken primer-template duplex stability. The calculator applies a simple reduction for each DMSO percentage point.

5. What is the Q5 adjustment field?

It is an empirical correction for Q5-style planning. You can change it to match your protocol or validation data.

6. Which primer controls the pair range?

The lower primer Tm controls the pair recommendation. This helps both primers bind within a practical temperature window.

7. Can I export the results?

Yes. Use the CSV button for spreadsheet data. Use the PDF button for a simple downloadable report.

8. Why are my results different from another tool?

Different tools use different thermodynamic tables, salt corrections, and polymerase rules. Always validate important assays experimentally.

Related Calculators

Paver Sand Bedding Calculator (depth-based)Paver Edge Restraint Length & Cost CalculatorPaver Sealer Quantity & Cost CalculatorExcavation Hauling Loads Calculator (truck loads)Soil Disposal Fee CalculatorSite Leveling Cost CalculatorCompaction Passes Time & Cost CalculatorPlate Compactor Rental Cost CalculatorGravel Volume Calculator (yards/tons)Gravel Weight Calculator (by material type)

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.