IDT Melting Temperature Calculator

Estimate oligo stability using salt, concentration, GC, length, and mismatch details. Compare saved cases simply. Review quick outputs before ordering or planning experiments today.

Calculator Inputs

Example Data Table

Sequence Na mM Mg mM GC % Estimated Tm Use Case
ATGCGTACGTTAGCCTAAGC 50 1.5 50.00 Screening range Standard primer
GGCGGATCCGCTTAGCGGCA 75 2.0 70.00 Higher range GC rich design
ATATATGCAATTAATGCATA 35 1.0 25.00 Lower range AT rich design

Formula Used

For sequences under 14 bases, the calculator uses the Wallace rule.

Base Tm = 2 × (A + T) + 4 × (G + C)

For longer oligos, it uses a salt adjusted screening equation.

Base Tm = 81.5 + 16.6 × log10(NaEq) + 0.41 × GC% - 600 / Length

NaEq mM = Na mM + 120 × square root of free Mg mM

Free Mg mM = max(Mg mM - dNTP mM, 0)

Final Tm = Base Tm + concentration correction - formamide penalty - mismatch penalty

The formula is an advanced estimate for comparison. Use validated nearest neighbor tools for final regulated or clinical work.

How To Use This Calculator

  1. Paste the primer or oligo sequence into the sequence field.
  2. Choose the sequence mode if uracil appears in your input.
  3. Enter oligo concentration and reaction salt values.
  4. Add magnesium, dNTP, formamide, and mismatch values when known.
  5. Enter a target melting temperature for comparison.
  6. Press the calculate button and review the result above the form.
  7. Use CSV or PDF export to save the calculation summary.

Overview

Melting temperature is a key number for primer design. It estimates the point where half of a DNA duplex is paired and half is separated. A higher value usually means stronger binding. A lower value suggests weaker pairing. This calculator is built for quick laboratory planning, teaching, and physics based comparison.

Why Tm Matters

Thermal motion competes with hydrogen bonding and base stacking. When temperature rises, random motion disrupts the duplex. GC rich regions resist this change better than AT rich regions. Salt also matters. Positive ions shield the phosphate backbone. That shielding lowers repulsion between strands and raises the estimated melting point.

Advanced Inputs

The form accepts sequence, oligo concentration, sodium, magnesium, dNTP, formamide, and mismatch values. These inputs help model real reaction conditions. Magnesium is converted into a sodium equivalent. Free magnesium is reduced by dNTP because dNTP can bind magnesium. Formamide and mismatch reduce stability. Concentration adds a small correction because strand pairing depends on molecule abundance.

Interpreting Results

The result is an estimate, not a certificate. Nearest neighbor models may be more exact for final ordering. Still, this approach is useful for screening many oligos. It shows GC percent, adjusted salt, base method, and final corrected value. It also warns when a sequence is short, long, very AT rich, or very GC rich.

Practical Primer Planning

For many PCR designs, paired primers should have similar melting temperatures. A difference below five degrees is often easier to tune. Avoid long homopolymer runs. Check secondary structures when accuracy matters. Use the same salt and concentration settings for every primer in a project. That keeps comparisons fair.

Physics View

The calculation reflects energy balance. Base pairs and stacking lower free energy. Heat adds disorder. Salt changes electrostatic forces. Solvent additives change duplex stability. The final number is therefore a practical thermal threshold. It links molecular structure with experimental temperature choice.

Using Exports

The CSV file stores the main inputs and outputs. It is useful for notebooks, audits, and batch comparisons. The report file gives a compact summary for sharing. Save both after each design round. Then you can trace why a primer set was accepted, rejected, or changed. This supports repeatable decisions during careful wet lab review workflows.

FAQs

What does melting temperature mean?

It is the estimated temperature where half of the duplex is paired and half is separated. It helps compare primer stability.

Is this an official ordering calculator?

No. It is an educational and planning tool. Use supplier validated tools when exact ordering conditions are required.

Why does GC content raise Tm?

GC pairs usually add stronger stacking and pairing effects. More GC content often gives a higher melting temperature.

Why does salt affect the result?

Salt shields charged phosphate groups. This reduces strand repulsion and can increase duplex stability.

How does magnesium change the estimate?

Magnesium can strongly stabilize nucleic acid duplexes. The calculator converts free magnesium into a sodium equivalent estimate.

What does mismatch percent do?

Mismatch percent applies a direct penalty. More mismatch lowers the final estimate because pairing becomes less stable.

Can I use RNA letters?

Yes. Select RNA style input. The calculator accepts U and counts it with the AT group for screening.

Why export CSV and PDF?

CSV helps spreadsheet review. PDF gives a compact report for records, sharing, and repeated primer design checks.

Related Calculators

Paver Sand Bedding Calculator (depth-based)Paver Edge Restraint Length & Cost CalculatorPaver Sealer Quantity & Cost CalculatorExcavation Hauling Loads Calculator (truck loads)Soil Disposal Fee CalculatorSite Leveling Cost CalculatorCompaction Passes Time & Cost CalculatorPlate Compactor Rental Cost CalculatorGravel Volume Calculator (yards/tons)Gravel Weight Calculator (by material type)

Important Note: All the Calculators listed in this site are for educational purpose only and we do not guarentee the accuracy of results. Please do consult with other sources as well.