Formula Used
Wallace rule: Tm = 2 × (A + T) + 4 × (G + C).
Basic GC formula: Tm = 64.9 + 41 × ((G + C - 16.4) / N).
Salt adjusted GC: Tm = 81.5 + 16.6 × log10(NaEq) + 0.41 × GC% - 675 / N.
Sodium equivalent: NaEq mM = Na mM + 120 × square root of active Mg mM.
Nearest neighbor: Tm = ΔH / (ΔS + R × ln(Ct / factor)) with salt and correction terms.
Correction: mismatch penalty + 0.72 × formamide percent + 0.75 × DMSO percent.
How to Use This Calculator
Paste a DNA sequence into the sequence box. Spaces, line breaks, and FASTA headers are ignored.
Select a calculation method. Use auto mode when you want the tool to choose a practical formula.
Enter salt, magnesium, dNTP, concentration, mismatch, formamide, and DMSO values. Leave default values when unknown.
Press calculate to show the result below the header. Use CSV or PDF buttons to save the current run.
Example Data Table
| Example |
Sequence |
Length |
GC% |
Method |
Tm °C |
| Short primer |
ATGCGTACGTTAGC |
14 |
50.00 |
Nearest neighbor |
45.21 |
| GC rich primer |
GGCGGATCCGCGGCTAAGC |
19 |
73.68 |
Nearest neighbor |
65.61 |
| AT rich primer |
ATATGTTATTAATGTA |
16 |
12.50 |
Nearest neighbor |
31.86 |
| Long fragment |
ATGCGTACGTTAGCGGATCCATGCGTACGTTAGCGGATCCATGCGTACGTTAGC |
54 |
53.70 |
Nearest neighbor |
78.37 |
Understanding DNA Melting Temperature
DNA melting temperature helps describe when two strands separate. The value is useful during primer design, cloning checks, probe planning, and basic thermal analysis. A higher value means the duplex is harder to separate. A lower value means binding is weaker. This calculator gives a practical estimate, not a final lab guarantee.
Why Inputs Matter
Several inputs can move the result. GC pairs raise stability because they form stronger stacking patterns. Longer sequences also usually raise stability. Salt shields the negative DNA backbone. More salt can increase the predicted temperature. Magnesium may have a strong effect, so the tool converts magnesium and dNTP values into a sodium equivalent.
Method Choice
Primer concentration matters for short oligos. The nearest neighbor option includes concentration through a thermodynamic expression. It adds dinucleotide enthalpy and entropy values across the sequence. This method is often better for primers than a simple base count. Wallace and GC formulas are still useful for fast screening and teaching.
Correction Factors
Mismatch, formamide, and DMSO fields allow quick penalty checks. A mismatch usually lowers duplex strength. Formamide and DMSO also reduce the effective melting temperature. These adjustments help when planning difficult reactions or checking old protocols. They should be treated as planning guides.
Sequence Review
Good sequence review is still needed. Avoid very long single base runs. Check for unwanted hairpins and dimers with dedicated tools. Compare both primers in the same reaction. Similar melting values improve balanced binding. Extreme GC content may need additives, slower cycling, or redesign.
Using Results
Use the suggested annealing range as a starting point. Many PCR setups begin several degrees below primer melting temperature. Then they are refined by gradient testing. Try to keep primer pairs within a narrow temperature band. Also watch GC percent, long repeats, and weak end clamps. These details can affect specificity.
The result panel shows base counts, GC percent, sodium equivalent, several formulas, and warnings. Use the export buttons to save the current calculation. The example table shows typical inputs and expected outputs. Always confirm important designs with experimental controls and accepted laboratory guidelines. For best notes, record the method, salt settings, concentration, sequence source, and final wet lab result after testing each time.
FAQs
What is DNA melting temperature?
DNA melting temperature is the estimated point where half of a DNA duplex becomes single stranded. It helps compare primer or fragment stability.
Which method should I choose?
Use auto mode for general work. It selects Wallace for very short sequences, nearest neighbor for primers, and salt adjusted GC for longer fragments.
Why does salt change the result?
Salt shields the negatively charged DNA backbone. Higher ionic strength usually stabilizes duplex formation and can raise the predicted melting temperature.
What does sodium equivalent mean?
Sodium equivalent combines monovalent salt and active magnesium into one practical salt value. It helps simplify salt adjusted temperature formulas.
Why is primer concentration included?
Primer concentration affects duplex formation. The nearest neighbor formula uses concentration because short oligo binding depends on strand amount.
Can I use this for PCR annealing?
Yes, use the annealing range as a starting guide. Final annealing temperature should be refined with gradient testing and protocol needs.
How are mismatches handled?
The mismatch field applies a simple penalty per mismatch. It is useful for rough planning, but exact mismatch effects depend on position and sequence.
Are the results final laboratory values?
No. These values are estimates. Lab conditions, enzyme systems, additives, template quality, and primer structure can change real performance.