Calculator Inputs
Example Data Table
This sample table shows common RNA inputs and estimated use cases.
| RNA Type | Example Sequence | Length | Useful Setting | Typical Use |
|---|---|---|---|---|
| siRNA guide | AUGCUACGUAGCUAUGCUA | 19 nt | 5′OH / 3′OH | Transfection planning |
| mRNA fragment | AUGGCUACGUUACGGAUCCU | 20 nt | Average mass | Mass conversion |
| Triphosphorylated RNA | GGGAAAUUUCCCGGG | 15 nt | 5′ triphosphate | In vitro transcription |
| Modified RNA | ACGUACGUACGU | 12 nt | Custom mass | Label correction |
Formula Used
The calculator uses a nucleotide residue mass model. It first counts each base. Then it applies the selected average or monoisotopic residue mass.
Base mass:
Base Mass = A×MassA + U×MassU + G×MassG + C×MassC
Final molecular weight:
MW = Base Mass + Terminal Adjustment + Custom Modification + Sodium Adjustment
Sodium adjustment:
Sodium Adjustment = Phosphate Count × Sodium Fraction × 21.981943
Standard 5′OH and 3′OH RNA is adjusted by adding terminal water and removing one terminal phosphate equivalent from the residue model. A 5′ phosphate, 5′ triphosphate, or 3′ phosphate changes that terminal correction.
How to Use This Calculator
- Paste an RNA sequence into the sequence box.
- Leave the sequence blank when using manual base counts.
- Select average mass for routine laboratory planning.
- Select monoisotopic mass for exact mass checks.
- Choose the correct 5′ and 3′ terminal chemistry.
- Add any label, cap, linker, or modification mass.
- Enter sodium replacement when salt-form mass is needed.
- Press the calculate button and review the result above the form.
- Download the CSV or PDF summary for records.
RNA Molecular Weight Guide
Why RNA Mass Matters
RNA molecular weight connects sequence design with practical laboratory handling. It helps convert between mass, moles, copy number, and concentration. These conversions are important for primers, guide RNAs, probes, standards, and transcripts. A small mass error can change molar delivery in sensitive assays.
Sequence Based Calculation
Each RNA base contributes a known residue mass. Adenine, uracil, guanine, and cytosine have different masses. The calculator counts each base from the submitted sequence. It also accepts manual counts when a full sequence is not available. Ambiguous symbols can be averaged, which is useful for draft designs.
Terminal Chemistry
RNA ends affect the final value. A standard synthetic oligo often has 5′ hydroxyl and 3′ hydroxyl ends. Some transcripts carry a 5′ triphosphate. Other molecules may include terminal phosphate groups. Choosing the correct end setting improves the reported molecular weight.
Mass Models
Average mass is suitable for most bench calculations. It reflects natural isotopic abundance. Monoisotopic mass is useful for high resolution mass spectrometry. The difference becomes more visible as the RNA becomes longer. This tool gives both chemistry and conversion options in one page.
Modification Support
Many RNA molecules include labels, caps, linkers, or modified bases. Enter the net modification mass as a custom value. Use a positive value for added mass. Use a negative value for a removed group. This makes the calculator flexible for advanced workflows.
Export and Review
The result section lists counts, GC content, terminal adjustment, and conversions. It also reports micrograms per nanomole and pmol per microgram. These values help prepare stocks and dilutions. CSV export supports spreadsheets. PDF export supports review, sharing, and documentation.
FAQs
1. What does this RNA molecular weight calculator measure?
It estimates the molecular weight of an RNA molecule using sequence, base counts, terminal groups, modifications, and optional salt correction.
2. Should I use average or monoisotopic mass?
Use average mass for routine concentration and ordering work. Use monoisotopic mass when comparing exact theoretical mass with high resolution spectra.
3. Can I calculate from base counts only?
Yes. Leave the sequence field blank. Then enter A, U, G, and C counts manually. The calculator will use those counts.
4. What happens to ambiguous RNA symbols?
Ambiguous symbols are averaged across their possible bases. For example, N is treated as an equal mix of A, U, G, and C.
5. Why do terminal groups change the answer?
Terminal groups add or remove chemical mass. A 5′ phosphate, 5′ triphosphate, or 3′ phosphate changes the final molecular weight.
6. What is the custom modification mass field?
It lets you add labels, caps, linkers, modified bases, or other chemistry. Enter the net mass change in grams per mole.
7. What does sodium replacement mean?
RNA phosphates can carry counterions. Sodium replacement estimates added mass when acidic phosphate hydrogens are replaced by sodium ions.
8. Can I export the calculation?
Yes. After calculation, use the CSV button for spreadsheet data or the PDF button for a clean report summary.