Nucleotide Results
| Metric | Value |
|---|---|
| Input sequence | — |
| Type / Strandedness | — |
| Length (nt) | — |
| Base counts | — |
| GC content (%) | — |
| Complement (if ds) | — |
| Molecular weight (g/mol) | — |
| Molecular weight (kDa) | — |
| Mass per μmol (mg/μmol) | — |
| Assumptions | Residue masses based on average isotopic composition. |
Computation uses average base masses and subtracts water per linkage: MW = Σ(base masses) − (n − 1) × 18.015. Terminal monophosphates add ~79.0 g/mol. Double-stranded MW sums both strands.
Example Data
| Label | Type | Strand | Ends | Sequence | |
|---|---|---|---|---|---|
| DNA CDS example | DNA | ss | none/none | ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG | |
| RNA 8mer | RNA | ss | 5′P/none | AUGCNRYS | |
| DNA ds short | DNA | ds | none/3′P | NNNNRYSW |
Click Load to populate the form from any example row, then press Compute Nucleotide MW.
Protein Molecular Weight from Nucleotide Sequence
| Metric | Value |
|---|---|
| Input (processed) | — |
| Strand / Frame | — |
| Protein sequence | — |
| Length (aa) | — |
| Residue counts | — |
| Stop codons encountered | — |
| Molecular weight (g/mol) | — |
| Molecular weight (kDa) | — |
| Mass per μmol (mg/μmol) | — |
| Assumptions | Average amino-acid masses; peptide MW = Σ(AA) − (n − 1)×18.015. |
Translation uses the selected genetic code. Reverse complement translates the opposite strand. For coding sequences, use frame +1 and truncate at the first stop.
Formulas Used
- Base masses (DNA): A 313.21, C 289.18, G 329.21, T 304.20 g/mol.
- Base masses (RNA): A 329.21, C 305.18, G 345.21, U 306.17 g/mol.
- Polymerization water loss: one H2O (18.015 g/mol) per linkage; for length n, linkages = n − 1.
- Phosphorylation: add ~79.0 g/mol for a terminal monophosphate at 5′ or 3′.
- Double-stranded: MWds = MWstrand + MWcomplement.
- Protein mass: Σ(free amino-acid masses) − (n − 1) × 18.015; n = residues.
Values are typical averages used in oligo and peptide calculations. Exact values can vary slightly by reference or ionic state.
How to Use This Calculator
- Paste or type your sequence into the Sequence box.
- For nucleotide mass: select type, strandedness, phosphorylation, then compute.
- For protein mass: choose genetic code, frame, and reverse complement if needed.
- Choose stop and unknown-codon handling, then translate and compute mass.
- Export your nucleotide or protein results as CSV or PDF.
Tip: Use the CDS example to test protein translation quickly.
IUPAC Codes Supported
| Code | Meaning |
|---|---|
| A C G T/U | Standard unambiguous bases |
| R | A or G |
| Y | C or T/U |
| S | G or C |
| W | A or T/U |
| K | G or T/U |
| M | A or C |
| B | C, G or T/U |
| D | A, G or T/U |
| H | A, C or T/U |
| V | A, C or G |
| N | A, C, G or T/U |
Residue Masses: DNA vs RNA (g/mol)
| Base | DNA residue mass | RNA residue mass |
|---|---|---|
| A | 313.21 | 329.21 |
| C | 289.18 | 305.18 |
| G | 329.21 | 345.21 |
| T / U | 304.20 | 306.17 |
Residue masses represent monomers within the polymer chain; final MW subtracts one water per phosphodiester linkage.
Worked Example: 12‑nt DNA Oligo MW
Sequence: ACGTACGTACGT (n = 12)
- Count bases: A:3, C:3, G:3, T:3.
- Sum base masses: 3×313.21 + 3×289.18 + 3×329.21 + 3×304.20 = 3707.40 g/mol.
- Water loss: (n − 1) × 18.015 = 11 × 18.015 = 198.165 g/mol.
- MW (ss DNA): 3707.40 − 198.165 = 3509.24 g/mol (≈ 3.509 kDa).
For double‑stranded oligos, add the mass of the complementary strand (with its own termini).
Common End Modifications and Mass Adders
| Modification | Approximate mass change (g/mol) | Notes |
|---|---|---|
| 5′ monophosphate | +79.0 | Add to nucleotide MW for a phosphorylated 5′ end. |
| 3′ monophosphate | +79.0 | Add to nucleotide MW for a phosphorylated 3′ end. |
| Both ends monophosphorylated | +158.0 | Sum of 5′ and 3′ monophosphates. |
| No phosphorylation (default) | 0 | Neutral termini (OH/PO3− depends on context). |
Reporting is for neutral molecular weight. Salt/adduct forms in MS can shift observed m/z without changing neutral formula mass.